Polish Journal of Pathology
eISSN: 2084-9869
ISSN: 1233-9687
Polish Journal of Pathology
Current issue Archive Manuscripts accepted About the journal Editorial board Abstracting and indexing Subscription Contact Ethical standards and procedures Supplements Instructions for authors Publication charge
Editorial System
Submit your Manuscript
SCImago Journal & Country Rank
4/2016
vol. 67
 
Share:
Share:
Case report

Puzzle histiocytosis (solitary mononuclear xanthogranuloma with LCH component). A case report*

Katarzyna Woszczyna-Mleczko
,
Artur Kowalik
,
Agnieszka Harazin-Lechowska
,
Piotr Bobkiewicz
,
Andrzej Marszałek
,
Janusz Ryś

Pol J Pathol 2016; 67 (4): 415-420
Online publish date: 2017/02/10
Article file
Get citation
 
PlumX metrics:
 

Introduction

Xanthogranuloma (XG) and Langerhans cell histiocytosis (LCH) both belong to the histiocytosis group of disorders, and are thought to originate from a common stem cell precursor [1]. What is more a rare cases presenting the overlapping features of LCH and juvenile xanthogranuloma (JXG) have been reported [2, 3, 4]. We describe an additional case of cutaneous lesion with the coexistence of both LCH and XG texture.

Case report

An otherwise healthy, 40-year old Caucasian man presented with a 2-year history of a slow-growing polypoid tumor of the right arm. He had no symptom of fever, malaise or weight loss. Physical examination revealed no sign of lymph nodes enlargement.
A macroscopic examination revealed white-blue skin nodule on the one-third lower part of the right arm, measuring 1 × 1.5 cm. The lesion was excised completely. The patient has been followed up for 20-months without recurrence.

Material and methods

The material was derived from consultation archive. The specimen was fixed in formalin and embedded in paraffin for routine hematoxylin and eosin stain. Immunohistochemical studies included CD68, CD163, Factor XIIIa, CD1a, S-100 protein, Langerin, smooth muscle actin, HMB45, melan A, cytokeratins, CD20, CD34, CD31 and anti-BRAF antibody. The details of immunohistochemical reagents are depicted in Table I. Genotyping of BRAF p.V600E (c.1799T>A) was performed using qPCR and Sanger sequencing as described previously [5, 6]. Briefly, the tumor tissue on the unstained slides was deparaffinized and transferred from the area selected by a pathologist to a tube for DNA isolation using the Maxwell® 16 FFPE Plus LEV DNA Purification Kit according to the manufacturer’s instructions (Promega, USA). We amplified a segment of exon 15 of BRAF 224 bp in length containing codon 600 using the following PCR primers: BRAFek15f (5’-TCATAATGCTTGCTCTGATAGGA-3’) and BRAFek15r (5’-GGCCAAAAATTTAATCAGTGGA-3’). A qPCR assay targeting 68 bp of BRAF exon 15 was performed using Rotor-Gene Q (Qiagen, Syngen-Biotech, Poland) with the following primers: forward 5‘ agacctcacagtaaaaataggtgattttgg 3‘ and reverse 5‘ gatgggacccactccatcg 3‘. A BRAF mutant-specific probe (6FAM- CTACAGAGAAATC -MG-BNFQ) and BRAF-WT allele-specific probe (VIC- CTACAGTGAAATC -MGB-NFQ) were used.

Morphological characteristics of tumor

Macroscopically as well as on the lower magnification the polypoid tumor was confined to the skin (Fig. 1). The main histological components of the tumor consisted of the mixture of short spindle cells producing collagen fibers, lymphocytes, plasma cells, scattered eosinophils and histiocytoid cells (Figs. 2-3). The histiocytoid cells were characterized by oval, folded nuclei with fine chromatin, inconspicuous nucleoli and thin nuclear membrane. Some of them presented longitudinal nuclear grooves (Fig. 4). The vast majority of tumor cells lacked nuclear atypia, however, a few cells with atypia/pseudoatypia were noticed.
The additional component of the histological texture was a well circumscribed area (Fig. 1 appointed fragment) of mononucleated epithelioid cells characterized by coffee bean- or kidney-shaped nuclei and moderate amount of clear or eosinophilic cytoplasm (Fig. 5). The border between two components of neoplasm was sharp (Fig. 6).
Additionally, these two components of the lesion differed from each other immunohistochemically. The cells of both components stained with antibody against CD68, however the histiocytoid cells were positive for CD68, CD163, factor XIIIa and negative for CD1a, S-100 protein, Langerin, smooth muscle actin, HMB45, cytokeratins, CD20, CD34 and CD31. Contrary to above-mentioned histiocytioid cells, the mononucleated epithelioid cells were immunoreactive for CD1a, S100, Langerin and negative for CD20, CD31, CD34, CD163, SMA, HMB-45, CK, CD163, FXIIIa (Fig. 7). The results of immunohistochemical studies are depicted in the Table II.
The immunohistochemical and molecular tests for BRAF (V600E) mutation gave negative results. We did not find BRAF p.V600E (c.1799T>A) mutation in DNA isolated from both components.
Based on histopathologic and immunohistochemical findings, the puzzle tumor composed of solitary mononuclear xanthogranuloma with additional component of LCH texture was diagnosed.

Discussion

The histiocytoses are rare disorders characterized by the accumulation of cells thought to be derived from dendritic cells (DCs) or macrophages. The revised classification of histiocytoses and neoplasms of the macrophage-dendritic cell lineages consists of 5 categories of diseases:
• Langerhans-related (L-group), which includes LCH and Erdheim-Chester disease,
• cutaneous and mucocutaneous (C-group including JXG),
• malignant histiocytoses (M-group),
• Rosai-Dorfman disease (R-group),
• hemophagocytic lymphohistiocytosis and macrophage activation syndrome (H-group) [1].
Langerhans cell histiocytosis is a localized, multifocal, or disseminated condition characterized by often clonal accumulation of Langerhans-like cells that express CD1a, langerin (CD207), S-100 protein, and Birbeck granules by ultrastructural examination [7] (Table III). The diagnosis of LCH is based on clinical and radiological findings in combination with histopathological analyses identifying tissue infiltration by histiocytes with ultrastructural or immunophenotypic characteristics of LCs. Skin may be the only site of Langerhans cell disease, or it may be part of more widespread involvement. LCH may affect any organ of the body, but those more frequently affected in children are the bones (80% of cases), skin (33%), and the pituitary gland (25%) [1]. The proliferating Langerhans cells have abundant, often vacuolated cytoplasm and vesicular nuclei containing linear grooves or folds. The presence of Birbeck granules in the cytoplasm is characteristic. BRAF V600E mutations were found in 38% to 57% of LCH cases. MAP2K1 mutation is another known mutation [9].
Juvenile xanthogranuloma is a benign dermal histiocytic disorder that occurs as single or multiple yellowish nodules that usually involve primarily the head and neck, trunk, or upper extremities. Histologically, there is a nodular, poorly demarcated dense infiltrate of small histiocytes involving the dermis and sometimes the upper subcutis as well. Rarely, deep extension into skeletal muscle is present. Early lesions consist of monomorphic, histiocytic infiltrate. Mature lesions contain foamy histiocytes, Touton giant cells and foreign body giant cells, as well as mixed cellular infiltrate of lymphocytes, macrophages and eosinophils. Fibrosis may be prominent. Mitotic figures are rare [7, 8].
In our opinion the histological picture of presented lesion is built of the texture typical for both above mentioned categories of histiocytic proliferations (xanthogranuloma & Langerhans cell histiocytosis). What is more, the immunohistochemical profile of the both components confirmed the diagnosis of puzzle lesion and allows to exclude the selected lesions which are usually considered in the differential diagnosis of xanthogranuloma and LCH histiocytosis (Table III).
There are very few reports in literarure describing the two different types of histiocytoses coexisting in the same patient. Yu et al. reported the case of a 15-month-old boy with a histiocytosis of the skin with hybrid features of JXG and LCH [3]. Martín et al. described the case of multiple cutaneous lesions in a 10-year-old boy, in whom the coexistence of both LCH and JXG cell populations was found in every single lesion [4]. Shani-Adir et al. reported the case of a 2-years-old boy who referred with both JXG of the skin and LCH with bone involvement [2].
In addition, in the literature JXG was described as a sequel to LCH treated with chemotherapy [10].

The authors declare no conflict of interest.

References

1. Emile JF, Abla O, Fraitag S, et al. Revised classification of histiocytoses and neoplasms of the macrophage-dendritic cell lineages. Blood 2016; 127: 2672-2681.
2. Shani-Adir A, Chou P, Morgan E, et al. A Child with both Langerhans and non-Langerhans cell histiocytosis. Pediatr Dermatol 2002; 19: 419-422.
3. Yu H, Kong J, Gu Y, et al. A child with coexistent juvenile xanthogranuloma and Langerhans cell histiocytosis. J Am Acad Dermatol 2010; 62: 329-332.
4. Martín JM, Jordá E, Martín-Gorgojo A, et al. Histiocytosis with mixed cell populations. J Cutan Pathol 2016; 43: 456-460.
5. Lasota J, Kowalik A, Wasag B, et al. Detection of the BRAF V600E mutation in colon carcinoma: critical evaluation of the imunohistochemical approach. Am J Surg Pathol 2014; 38: 1235-1241.
6. Walczyk A, Kowalska A, Kowalik A, et al. The BRAF(V600E) mutation in papillary thyroid microcarcinoma: does the mutation have an impact on clinical outcome? Clin Endocrinol (Oxf) 2014; 80: 899-904.
7. Jaffe ES. Hematopathology. Saunders, Elsevier, Philadelphia 2011.
8. Weedon D, Strutton G, Rubin AI, Weedon D Weedon’s skin pathology. Churchill Livingstone, Elsevier, Edinburgh 2010
9. Brown NA, Furtado LV, Betz BL. High prevalence of somatic MAP2K1 mutations in BRAF V600E–negative Langerhans cell histiocytosis. Blood 2014; 124: 1655-1658.
10. Strehl JD, Stachel KD, Hartmann A, Agaimy A. Juvenile xanthogranuloma developing after treatment of Langerhans cell histiocytosis: case report and literature review. Int J Clin Exp Pathol 2012; 5: 720-725.

Address for correspondence

Katarzyna Woszczyna-Mleczko
Department of Tumour Pathology
Maria Sklodowska-Curie Memorial Cancer Centre
and Institute of Oncology
Krakow Branch, Poland
e-mail: kasia.woszczyna@gmail.com
Copyright: © 2017 Polish Association of Pathologists and the Polish Branch of the International Academy of Pathology This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License (http://creativecommons.org/licenses/by-nc-sa/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.
Quick links
© 2026 Termedia Sp. z o.o.
Developed by Termedia.